Transcript: Mouse XM_973315.4

PREDICTED: Mus musculus predicted gene 5724 (Gm5724), mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm5724 (435927)
Length:
3019
CDS:
181..2193

Additional Resources:

NCBI RefSeq record:
XM_973315.4
NBCI Gene record:
Gm5724 (435927)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_973315.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070028 CCTAAGACTTATGAGGACGTT pLKO.1 2037 CDS 100% 2.640 3.696 N Gm5724 n/a
2 TRCN0000070030 CCTTCTGTCTTTGTCTAACTA pLKO.1 1377 CDS 100% 5.625 3.938 N Gm5724 n/a
3 TRCN0000070031 CGTGTGTATCCAAATCACTAA pLKO.1 266 CDS 100% 4.950 3.465 N Gm5724 n/a
4 TRCN0000070029 GCTTTAGTATGGGAATGCTTT pLKO.1 371 CDS 100% 4.950 3.465 N Gm5724 n/a
5 TRCN0000070032 GAATGGAATCAACATGGTGTT pLKO.1 1602 CDS 100% 4.050 2.835 N Gm5724 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_973315.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.