Transcript: Human XR_001737281.2

PREDICTED: Homo sapiens ring finger protein 220 (RNF220), transcript variant X13, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNF220 (55182)
Length:
3781
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001737281.2
NBCI Gene record:
RNF220 (55182)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001737281.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162943 GCATGAGAACAACAACCGCTT pLKO.1 3355 3UTR 100% 2.160 1.728 N RNF220 n/a
2 TRCN0000275334 ACTACACCTCCACCCTCAATT pLKO_005 689 3UTR 100% 13.200 9.240 N RNF220 n/a
3 TRCN0000275287 GAGCTATCAGTCAGCCTTTAC pLKO_005 803 3UTR 100% 10.800 7.560 N RNF220 n/a
4 TRCN0000275376 GATCGGAATGACAGATGTAAG pLKO_005 1023 3UTR 100% 10.800 7.560 N RNF220 n/a
5 TRCN0000159227 CCAATCAGTATGCTGAATCAT pLKO.1 735 3UTR 100% 5.625 3.938 N RNF220 n/a
6 TRCN0000162152 CGGTTCACTAAAGGTTGATGA pLKO.1 935 3UTR 100% 4.950 3.465 N RNF220 n/a
7 TRCN0000161509 GTTCCTATACCTTTGCCTCTA pLKO.1 607 3UTR 100% 4.050 2.835 N RNF220 n/a
8 TRCN0000162362 CGTGCATATTCCTTTCACCAA pLKO.1 584 3UTR 100% 2.640 1.848 N RNF220 n/a
9 TRCN0000161359 GCAAGGAATATGACTTTGGGA pLKO.1 892 3UTR 100% 0.750 0.525 N RNF220 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001737281.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.