Transcript: Human XR_001738678.2

PREDICTED: Homo sapiens PAS domain containing serine/threonine kinase (PASK), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PASK (23178)
Length:
4189
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001738678.2
NBCI Gene record:
PASK (23178)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001738678.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199880 GCTGCAGACCTGCTTGATTAA pLKO.1 2093 3UTR 100% 13.200 18.480 N PASK n/a
2 TRCN0000195515 CTTACGGCTGAGTATACAGTT pLKO.1 2834 3UTR 100% 4.950 6.930 N PASK n/a
3 TRCN0000007053 CGCCAATATCATCAAGGTATT pLKO.1 3308 3UTR 100% 10.800 7.560 N PASK n/a
4 TRCN0000199084 CGTCATGTGACAGTCTCTTTG pLKO.1 877 3UTR 100% 10.800 7.560 N PASK n/a
5 TRCN0000414407 GTTACTTTAGAGATCGCAATT pLKO_005 3270 3UTR 100% 10.800 7.560 N PASK n/a
6 TRCN0000199253 CCTAGACCTCTTCGCTTTCAT pLKO.1 3386 3UTR 100% 5.625 3.938 N PASK n/a
7 TRCN0000007055 CCTTGCGTACAACAGCTCATT pLKO.1 1304 3UTR 100% 4.950 3.465 N PASK n/a
8 TRCN0000199716 GCCCTTGCTATGGGAGTGAAT pLKO.1 1954 3UTR 100% 4.950 3.465 N PASK n/a
9 TRCN0000011065 GCTGATGGAAAGCCAAGACAT pLKO.1 1493 3UTR 100% 4.950 3.465 N PASK n/a
10 TRCN0000007054 GCAGCATATCACAGACCTGAT pLKO.1 938 3UTR 100% 4.050 2.835 N PASK n/a
11 TRCN0000220687 CCTGGGCAAGAATATCACTTT pLKO.1 1253 3UTR 100% 4.950 2.970 N Pask n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001738678.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.