Transcript: Human XR_001738694.1

PREDICTED: Homo sapiens sushi, nidogen and EGF like domains 1 (SNED1), transcript variant X13, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SNED1 (25992)
Length:
8347
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001738694.1
NBCI Gene record:
SNED1 (25992)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001738694.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056123 GCGAAACAGTAACAACAAGAA pLKO.1 3270 3UTR 100% 4.950 6.930 N SNED1 n/a
2 TRCN0000056124 CCACTACATTGGCAAATACAA pLKO.1 2223 3UTR 100% 5.625 3.938 N SNED1 n/a
3 TRCN0000056126 CGGGATCATCTCCTTCCTGAA pLKO.1 543 3UTR 100% 4.050 2.835 N SNED1 n/a
4 TRCN0000056127 TGAATTTGAAATCACAGCCAT pLKO.1 1815 3UTR 100% 2.640 1.848 N SNED1 n/a
5 TRCN0000056125 GACACCAAAGAGTGTCAACAT pLKO.1 1378 3UTR 100% 0.495 0.347 N SNED1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001738694.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.