Transcript: Human XR_001738924.1

PREDICTED: Homo sapiens RFX family member 8, lacking RFX DNA binding domain (RFX8), transcript variant X11, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RFX8 (731220)
Length:
1908
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001738924.1
NBCI Gene record:
RFX8 (731220)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001738924.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156630 GAAACCACTGAAAGCGCAGTT pLKO.1 1553 3UTR 100% 4.050 5.670 N RFX8 n/a
2 TRCN0000157718 CCTGGCATCTGTTTCACTTGT pLKO.1 1215 3UTR 100% 4.950 3.465 N RFX8 n/a
3 TRCN0000153450 CTGGCATCTGTTTCACTTGTT pLKO.1 1216 3UTR 100% 4.950 3.465 N RFX8 n/a
4 TRCN0000153812 CAGTTAAACTCAGCCTTCCTA pLKO.1 1569 3UTR 100% 3.000 2.100 N RFX8 n/a
5 TRCN0000158383 CATGGGCAATAAGCTCATCCA pLKO.1 1516 3UTR 100% 2.640 1.848 N RFX8 n/a
6 TRCN0000156667 GCAGTTAAACTCAGCCTTCCT pLKO.1 1568 3UTR 100% 2.640 1.848 N RFX8 n/a
7 TRCN0000153107 GCATCTGTTTCACTTGTTGCT pLKO.1 1219 3UTR 100% 2.640 1.848 N RFX8 n/a
8 TRCN0000156477 CAATAAGCTCATCCAGGTGCT pLKO.1 1522 3UTR 100% 2.160 1.512 N RFX8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001738924.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.