Transcript: Human XR_001740228.2

PREDICTED: Homo sapiens retinoic acid receptor responder 1 (RARRES1), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RARRES1 (5918)
Length:
1884
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001740228.2
NBCI Gene record:
RARRES1 (5918)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001740228.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373358 TCTGAGACTCATCTGGGATTT pLKO_005 894 3UTR 100% 10.800 7.560 N RARRES1 n/a
2 TRCN0000379040 ACAGGTGTCACACTACTACTT pLKO_005 957 3UTR 100% 4.950 3.465 N RARRES1 n/a
3 TRCN0000063374 CCTTGGAAGCTCTTACGTGAT pLKO.1 921 3UTR 100% 4.050 2.835 N RARRES1 n/a
4 TRCN0000032124 GCTTCACTTCTTCAACTTCAA pLKO.1 727 3UTR 100% 4.950 3.465 N Adam24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001740228.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.