Transcript: Human XR_001740251.2

PREDICTED: Homo sapiens upstream binding protein 1 (UBP1), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UBP1 (7342)
Length:
1628
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001740251.2
NBCI Gene record:
UBP1 (7342)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001740251.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020563 CGGCTACAATACACAGAGCAT pLKO.1 565 3UTR 100% 2.640 3.696 N UBP1 n/a
2 TRCN0000297130 CGGCTACAATACACAGAGCAT pLKO_005 565 3UTR 100% 2.640 3.696 N UBP1 n/a
3 TRCN0000086552 CGATGGAATTCGGCTCTATAA pLKO.1 1428 3UTR 100% 0.000 0.000 N Ubp1 n/a
4 TRCN0000301999 CGATGGAATTCGGCTCTATAA pLKO_005 1428 3UTR 100% 0.000 0.000 N Ubp1 n/a
5 TRCN0000020561 GCATGATGAAACGCTTACTTA pLKO.1 426 3UTR 100% 5.625 3.938 N UBP1 n/a
6 TRCN0000278046 GCATGATGAAACGCTTACTTA pLKO_005 426 3UTR 100% 5.625 3.938 N UBP1 n/a
7 TRCN0000020560 GCCAGTTAAATGCGGTTGAAT pLKO.1 686 3UTR 100% 5.625 3.938 N UBP1 n/a
8 TRCN0000278047 GCCAGTTAAATGCGGTTGAAT pLKO_005 686 3UTR 100% 5.625 3.938 N UBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001740251.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.