Transcript: Human XR_001741133.1

PREDICTED: Homo sapiens poly(A) binding protein cytoplasmic 4 like (PABPC4L), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PABPC4L (132430)
Length:
4425
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001741133.1
NBCI Gene record:
PABPC4L (132430)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001741133.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246149 ATCTGGAATTGGGAACGTATT pLKO_005 821 3UTR 100% 10.800 15.120 N PABPC4L n/a
2 TRCN0000246151 TGAATGGAAGGGACATAAATG pLKO_005 1288 3UTR 100% 13.200 9.240 N PABPC4L n/a
3 TRCN0000246150 GGATCAATTAGCAGAGTTAAG pLKO_005 1488 3UTR 100% 10.800 7.560 N PABPC4L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001741133.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.