Transcript: Human XR_001741213.1

PREDICTED: Homo sapiens anaphase promoting complex subunit 4 (ANAPC4), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANAPC4 (29945)
Length:
2659
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001741213.1
NBCI Gene record:
ANAPC4 (29945)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001741213.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421755 TAGCTCCAGAGATAGTCATTA pLKO_005 2488 3UTR 100% 13.200 10.560 N ANAPC4 n/a
2 TRCN0000004362 GCTGGTACTTGTCTTGCATTA pLKO.1 654 3UTR 100% 10.800 8.640 N ANAPC4 n/a
3 TRCN0000305153 TAAGGAGACATACTGATATTT pLKO_005 1852 3UTR 100% 15.000 10.500 N Anapc4 n/a
4 TRCN0000431331 TAAGGAGACATACTGATATTT pLKO_005 1852 3UTR 100% 15.000 10.500 N ANAPC4 n/a
5 TRCN0000004361 CAGGAATCGAAGAAGCTATAA pLKO.1 1201 3UTR 100% 13.200 9.240 N ANAPC4 n/a
6 TRCN0000435566 GCCAGAAAGTTTACTCATATT pLKO_005 804 3UTR 100% 13.200 9.240 N ANAPC4 n/a
7 TRCN0000004364 GCTTTATGCTTATGGAATGTT pLKO.1 608 3UTR 100% 5.625 3.938 N ANAPC4 n/a
8 TRCN0000004363 CAAGGCTAGATGAACAGTGTA pLKO.1 2188 3UTR 100% 4.950 3.465 N ANAPC4 n/a
9 TRCN0000088359 GCTCTGGATTTATTGAGCTTT pLKO.1 592 3UTR 100% 4.950 3.465 N Anapc4 n/a
10 TRCN0000004365 GAAAGTATGAAAGCACAGTAT pLKO.1 2259 3UTR 100% 4.950 2.970 N ANAPC4 n/a
11 TRCN0000305090 AGTCTATAGAGTCATCATATT pLKO_005 1054 3UTR 100% 13.200 9.240 N Anapc4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001741213.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.