Transcript: Human XR_001741226.2

PREDICTED: Homo sapiens methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2 like (MTHFD2L), transcript variant X15, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MTHFD2L (441024)
Length:
1907
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001741226.2
NBCI Gene record:
MTHFD2L (441024)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001741226.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265805 CCAAGAGTCAGCGGTATATTA pLKO_005 815 3UTR 100% 15.000 21.000 N Mthfd2l n/a
2 TRCN0000051374 CCCAAGAGTCAGCGGTATATT pLKO.1 814 3UTR 100% 15.000 21.000 N MTHFD2L n/a
3 TRCN0000051376 CCTCTGCTGTAGGTATTTGTA pLKO.1 720 3UTR 100% 5.625 3.938 N MTHFD2L n/a
4 TRCN0000051375 GCCATACATATGTCAGGAATA pLKO.1 687 3UTR 100% 0.000 0.000 N MTHFD2L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001741226.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.