Transcript: Human XR_001742032.1

PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif 16 (ADAMTS16), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADAMTS16 (170690)
Length:
4777
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001742032.1
NBCI Gene record:
ADAMTS16 (170690)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001742032.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046798 GCCGCCAGTATCTACACAAAT pLKO.1 1562 3UTR 100% 13.200 18.480 N ADAMTS16 n/a
2 TRCN0000436058 GACTACAGACGGTCCTATAAT pLKO_005 2587 3UTR 100% 15.000 10.500 N ADAMTS16 n/a
3 TRCN0000431958 ATCTTGCCAGATGAGTATAAG pLKO_005 934 3UTR 100% 13.200 9.240 N ADAMTS16 n/a
4 TRCN0000046799 GCCATCGTATTGGAAGGAAAT pLKO.1 1766 3UTR 100% 10.800 7.560 N ADAMTS16 n/a
5 TRCN0000046802 CCTGTGAAGGAATACAAGTAT pLKO.1 1627 3UTR 100% 5.625 3.938 N ADAMTS16 n/a
6 TRCN0000046801 CCAACCAACGAGACACTGATT pLKO.1 2635 3UTR 100% 4.950 3.465 N ADAMTS16 n/a
7 TRCN0000046800 GCACTAAGTCTGTGCAGACTT pLKO.1 533 3UTR 100% 0.495 0.347 N ADAMTS16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001742032.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.