Transcript: Human XR_001742067.2

PREDICTED: Homo sapiens mannosidase alpha class 2A member 1 (MAN2A1), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAN2A1 (4124)
Length:
7187
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001742067.2
NBCI Gene record:
MAN2A1 (4124)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001742067.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049617 GCTACTGTGAATACACGGAAT pLKO.1 2284 3UTR 100% 4.050 5.670 N MAN2A1 n/a
2 TRCN0000413818 AGACTTTCAATGACTACTTTA pLKO_005 1546 3UTR 100% 13.200 10.560 N MAN2A1 n/a
3 TRCN0000422780 AGATTGTATCTCAGGTTAAAT pLKO_005 4851 3UTR 100% 15.000 10.500 N MAN2A1 n/a
4 TRCN0000049613 CCCTGAGACAAGCTCACAAAT pLKO.1 2605 3UTR 100% 13.200 9.240 N MAN2A1 n/a
5 TRCN0000426409 GTATGAATTGATGCAACAAAT pLKO_005 4801 3UTR 100% 13.200 9.240 N MAN2A1 n/a
6 TRCN0000428480 TGCCGATCGAGATGATCATTA pLKO_005 2489 3UTR 100% 13.200 9.240 N MAN2A1 n/a
7 TRCN0000421244 TTCTTGGTTTGACGTGCAATA pLKO_005 4606 3UTR 100% 10.800 7.560 N MAN2A1 n/a
8 TRCN0000049615 GCAAGGATTTGACATTACTTA pLKO.1 1448 3UTR 100% 5.625 3.938 N MAN2A1 n/a
9 TRCN0000049614 CCACATAACTTCTTCTCTCAT pLKO.1 4143 3UTR 100% 4.950 3.465 N MAN2A1 n/a
10 TRCN0000049616 GCCTACCTCTTCTTACCTGAT pLKO.1 3544 3UTR 100% 4.050 2.835 N MAN2A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001742067.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.