Transcript: Human XR_001742121.1

PREDICTED: Homo sapiens protein geranylgeranyltransferase type I subunit beta (PGGT1B), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PGGT1B (5229)
Length:
13267
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001742121.1
NBCI Gene record:
PGGT1B (5229)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001742121.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337197 AGACGACTTAAGCCGAGTAAA pLKO_005 444 3UTR 100% 13.200 18.480 N PGGT1B n/a
2 TRCN0000189203 GCCTGTCACTAATGGAGGAAA pLKO.1 973 3UTR 100% 4.950 3.960 N PGGT1B n/a
3 TRCN0000337198 TTATCATGGAAGACCTAATAA pLKO_005 767 3UTR 100% 15.000 10.500 N PGGT1B n/a
4 TRCN0000337132 CATAACTGTAGCTCAAGTTTA pLKO_005 1160 3UTR 100% 13.200 9.240 N PGGT1B n/a
5 TRCN0000187927 GACGACTTAAGCCGAGTAAAT pLKO.1 445 3UTR 100% 13.200 9.240 N PGGT1B n/a
6 TRCN0000337131 GGATAAAGAGGTGGTGTATAA pLKO_005 730 3UTR 100% 13.200 9.240 N PGGT1B n/a
7 TRCN0000186553 GCATAACTGTAGCTCAAGTTT pLKO.1 1159 3UTR 100% 5.625 3.938 N PGGT1B n/a
8 TRCN0000202578 CCAATACACTAACTTTGAGAA pLKO.1 848 3UTR 100% 4.950 3.465 N PGGT1B n/a
9 TRCN0000337199 TGGTGAACAAAGATGATATAA pLKO_005 233 3UTR 100% 15.000 9.000 N PGGT1B n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 12115 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001742121.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.