Transcript: Human XR_001742351.1

PREDICTED: Homo sapiens neuregulin 2 (NRG2), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NRG2 (9542)
Length:
2271
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001742351.1
NBCI Gene record:
NRG2 (9542)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001742351.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058863 GCCGAGACATTCGCATCAAAT pLKO.1 1203 3UTR 100% 13.200 18.480 N NRG2 n/a
2 TRCN0000438742 GGTGCCAACTTTCGAGATCAC pLKO_005 2129 3UTR 100% 4.050 5.670 N NRG2 n/a
3 TRCN0000434416 CAGAAAGAACTCACGACTACA pLKO_005 1234 3UTR 100% 4.950 3.960 N NRG2 n/a
4 TRCN0000455012 TCGAAAGGAACCAGCGCTACA pLKO_005 927 3UTR 100% 4.050 3.240 N NRG2 n/a
5 TRCN0000433268 TAGTCTTTAAGACGGCCTTTG pLKO_005 978 3UTR 100% 6.000 4.200 N NRG2 n/a
6 TRCN0000446019 GGGTGAGAAGCAATCGCTGAA pLKO_005 1111 3UTR 100% 4.050 2.835 N NRG2 n/a
7 TRCN0000058867 GCCAAGTCCTATTGCGTCAAT pLKO.1 1409 3UTR 100% 4.950 2.970 N NRG2 n/a
8 TRCN0000058865 GCCCAAGTTGAAGAAGATGAA pLKO.1 1072 3UTR 100% 4.950 2.970 N NRG2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001742351.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.