Transcript: Human XR_001742370.2

PREDICTED: Homo sapiens tetratricopeptide repeat domain 37 (TTC37), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TTC37 (9652)
Length:
3434
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001742370.2
NBCI Gene record:
TTC37 (9652)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001742370.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143088 GCGAGGACTATACTATTTGAA pLKO.1 1979 3UTR 100% 5.625 7.875 N TTC37 n/a
2 TRCN0000143544 GCTCTGAAGATCGTAGATAAT pLKO.1 1266 3UTR 100% 13.200 9.240 N TTC37 n/a
3 TRCN0000143807 GCTCTGGCAATAACTGAATAT pLKO.1 3407 3UTR 100% 13.200 9.240 N TTC37 n/a
4 TRCN0000141824 GCTGATTTACAGGCAGCATTA pLKO.1 2025 3UTR 100% 10.800 7.560 N TTC37 n/a
5 TRCN0000142184 GCAGATAATATCCCAGGACTT pLKO.1 1416 3UTR 100% 4.050 2.835 N TTC37 n/a
6 TRCN0000139955 GCTGAATTAGAGCCAGACCAA pLKO.1 471 3UTR 100% 2.640 1.848 N TTC37 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001742370.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.