Transcript: Human XR_001743464.2

PREDICTED: Homo sapiens ectonucleotide pyrophosphatase/phosphodiesterase 3 (ENPP3), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ENPP3 (5169)
Length:
2849
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001743464.2
NBCI Gene record:
ENPP3 (5169)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001743464.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416885 AGAACGTCAGAATCGACAAAG pLKO_005 1438 3UTR 100% 10.800 15.120 N ENPP3 n/a
2 TRCN0000048999 CCTGTTAAGAAGAACACTCTT pLKO.1 117 3UTR 100% 4.950 6.930 N ENPP3 n/a
3 TRCN0000049002 GCATGTAAAGACCGAGGTGAT pLKO.1 303 3UTR 100% 4.050 5.670 N ENPP3 n/a
4 TRCN0000438100 AGGCCTGAAGCAGCGGAATTT pLKO_005 1145 3UTR 100% 13.200 10.560 N ENPP3 n/a
5 TRCN0000048998 CCAGACTTATTGTAACAAGAT pLKO.1 1211 3UTR 100% 4.950 3.960 N ENPP3 n/a
6 TRCN0000415262 AGGAGGCAACCATGGTTATAA pLKO_005 1520 3UTR 100% 15.000 10.500 N ENPP3 n/a
7 TRCN0000427277 GTGGTTAGTGGACCAATATTT pLKO_005 2431 3UTR 100% 15.000 10.500 N ENPP3 n/a
8 TRCN0000049000 CCGGATCAGAAGTGGCTATAA pLKO.1 898 3UTR 100% 13.200 9.240 N ENPP3 n/a
9 TRCN0000174090 CCGGATCAGAAGTGGCTATAA pLKO.1 898 3UTR 100% 13.200 9.240 N ENPP3 n/a
10 TRCN0000445404 GGAGCATGGAGGCTATCTTTC pLKO_005 1552 3UTR 100% 10.800 7.560 N ENPP3 n/a
11 TRCN0000431549 TTTGACCTGCCACCAGTTATC pLKO_005 549 3UTR 100% 10.800 7.560 N ENPP3 n/a
12 TRCN0000049001 GCACCAAACAATGGAACCCAT pLKO.1 1671 3UTR 100% 2.640 1.848 N ENPP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001743464.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.