Transcript: Human XR_001743485.2

PREDICTED: Homo sapiens Abelson helper integration site 1 (AHI1), transcript variant X14, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AHI1 (54806)
Length:
5757
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001743485.2
NBCI Gene record:
AHI1 (54806)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001743485.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135184 CGGCCTGTTTCATCTTACTAT pLKO.1 1546 3UTR 100% 5.625 7.875 N AHI1 n/a
2 TRCN0000164057 CGGAGACATTATCCGAGTGTT pLKO.1 3612 3UTR 100% 4.950 6.930 N AHI1 n/a
3 TRCN0000137208 GCTTGCCGTATCCCAAACAAA pLKO.1 2170 3UTR 100% 5.625 4.500 N AHI1 n/a
4 TRCN0000162243 CCCGGTTTATCCCAAATGTTT pLKO.1 1383 3UTR 100% 5.625 3.938 N AHI1 n/a
5 TRCN0000158446 CCAGAATATGAAGTATCTGTT pLKO.1 4506 3UTR 100% 4.950 3.465 N AHI1 n/a
6 TRCN0000159572 CCCAGTGTGAAATATCTTCTA pLKO.1 5413 3UTR 100% 4.950 3.465 N AHI1 n/a
7 TRCN0000163036 GCCATATTGGTCCGACAGTTT pLKO.1 2590 3UTR 100% 4.950 3.465 N AHI1 n/a
8 TRCN0000159711 GTCTAAGTTAAAGCAGTCAAA pLKO.1 3429 3UTR 100% 4.950 3.465 N AHI1 n/a
9 TRCN0000136362 CCATGTATTCTGACTTGCCAT pLKO.1 3026 3UTR 100% 2.640 1.848 N AHI1 n/a
10 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 4651 3UTR 100% 13.200 6.600 Y IQCC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001743485.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.