Transcript: Human XR_001743588.1

PREDICTED: Homo sapiens solute carrier family 22 member 3 (SLC22A3), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC22A3 (6581)
Length:
4048
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001743588.1
NBCI Gene record:
SLC22A3 (6581)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001743588.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415574 GGTATGGCAGGATCGTCATTT pLKO_005 575 3UTR 100% 13.200 18.480 N SLC22A3 n/a
2 TRCN0000038613 GCAGTGGTGTATCAAGGACTT pLKO.1 1028 3UTR 100% 4.050 3.240 N SLC22A3 n/a
3 TRCN0000038610 CCCAACAACATTACGAAATTT pLKO.1 1327 3UTR 100% 15.000 10.500 N SLC22A3 n/a
4 TRCN0000435593 TTTACCCTTGGAATCATAATT pLKO_005 790 3UTR 100% 15.000 10.500 N SLC22A3 n/a
5 TRCN0000433187 CGCTTCCTGCAAGGTGTATTT pLKO_005 676 3UTR 100% 13.200 9.240 N SLC22A3 n/a
6 TRCN0000038612 CCTGTAAATGTGGCAGGAATA pLKO.1 1563 3UTR 100% 10.800 7.560 N SLC22A3 n/a
7 TRCN0000414529 GGATTGTGGGAATCGTGATTC pLKO_005 761 3UTR 100% 10.800 7.560 N SLC22A3 n/a
8 TRCN0000038611 CCCTGGAATTGCCTACTTCAT pLKO.1 813 3UTR 100% 4.950 3.465 N SLC22A3 n/a
9 TRCN0000038609 GCACCAAACTTCCCTGTGTTT pLKO.1 646 3UTR 100% 4.950 3.465 N SLC22A3 n/a
10 TRCN0000070196 CTCATCAAATTACTCAGAGAT pLKO.1 999 3UTR 100% 4.950 3.465 N Slc22a3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001743588.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.