Transcript: Human XR_001744792.2

PREDICTED: Homo sapiens origin recognition complex subunit 5 (ORC5), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ORC5 (5001)
Length:
1784
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001744792.2
NBCI Gene record:
ORC5 (5001)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001744792.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000370826 TGAGCCGTTTGTCTTATATTT pLKO_005 625 3UTR 100% 15.000 21.000 N ORC5 n/a
2 TRCN0000365657 CTACACTGTTTGTCGAGATTT pLKO_005 754 3UTR 100% 13.200 18.480 N ORC5 n/a
3 TRCN0000149684 GCTTTACATTGAGGCTGCTTT pLKO.1 306 3UTR 100% 4.950 3.960 N ORC5 n/a
4 TRCN0000370890 ATGGATGTTCTACTGAAATAA pLKO_005 372 3UTR 100% 15.000 10.500 N ORC5 n/a
5 TRCN0000328030 TATTTGGAAGCAACGTGTTAA pLKO_005 1483 3UTR 100% 13.200 9.240 N Orc5 n/a
6 TRCN0000193540 GAGAGACATCATTTCAGCTTT pLKO.1 179 3UTR 100% 4.950 3.465 N Orc5 n/a
7 TRCN0000365656 TTTCTATGCTGCCTACATTAA pLKO_005 715 3UTR 100% 13.200 7.920 N ORC5 n/a
8 TRCN0000180968 GCTCCCACATGTGTTTGTGAA pLKO.1 274 3UTR 100% 4.950 2.970 N ORC5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001744792.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.