Transcript: Human XR_001744799.1

PREDICTED: Homo sapiens MLX interacting protein like (MLXIPL), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MLXIPL (51085)
Length:
3297
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001744799.1
NBCI Gene record:
MLXIPL (51085)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001744799.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429220 ACCCTTGGCAAACCTTTATAG pLKO_005 2613 3UTR 100% 13.200 9.240 N MLXIPL n/a
2 TRCN0000020078 CGCCTTCCTGAGTTCTGATTT pLKO.1 1332 3UTR 100% 13.200 9.240 N MLXIPL n/a
3 TRCN0000424177 GAGCTCAATGCCGCCATTAAC pLKO_005 2241 3UTR 100% 13.200 9.240 N MLXIPL n/a
4 TRCN0000412755 ACCAGATGCGAGACATGTTTG pLKO_005 2317 3UTR 100% 10.800 7.560 N MLXIPL n/a
5 TRCN0000020077 GCCTCTGTTTGAGTCCTTCAA pLKO.1 2402 3UTR 100% 4.950 3.465 N MLXIPL n/a
6 TRCN0000020074 GCTGAGTACATCCTTATGCTA pLKO.1 2163 3UTR 100% 3.000 2.100 N MLXIPL n/a
7 TRCN0000020075 CCCAAGTGGAAGAATTTCAAA pLKO.1 340 3UTR 100% 5.625 3.375 N MLXIPL n/a
8 TRCN0000020076 GCAATGGTGCAAACAGCTCTT pLKO.1 870 3UTR 100% 4.050 2.430 N MLXIPL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001744799.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.