Transcript: Human XR_001745522.1

PREDICTED: Homo sapiens mitochondrial calcium uptake family member 3 (MICU3), transcript variant X25, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MICU3 (286097)
Length:
4765
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001745522.1
NBCI Gene record:
MICU3 (286097)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001745522.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056084 CGAAGCTATTTCGAAATCTTA pLKO.1 657 3UTR 100% 5.625 7.875 N MICU3 n/a
2 TRCN0000056086 CGTTACAGTATACCTGAAGAA pLKO.1 1296 3UTR 100% 4.950 6.930 N MICU3 n/a
3 TRCN0000056083 GCCCTGAATATGTATAACTTT pLKO.1 1386 3UTR 100% 5.625 3.938 N MICU3 n/a
4 TRCN0000056087 CTGAGGAACTTGTCTCCAGAA pLKO.1 967 3UTR 100% 4.050 2.835 N MICU3 n/a
5 TRCN0000056085 GCAGTTATTCATGACTCCGTA pLKO.1 517 3UTR 100% 2.640 1.848 N MICU3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001745522.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.