Transcript: Human XR_001745621.1

PREDICTED: Homo sapiens potassium voltage-gated channel subfamily B member 2 (KCNB2), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KCNB2 (9312)
Length:
8342
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001745621.1
NBCI Gene record:
KCNB2 (9312)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001745621.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428245 TGCAGGAAACGGACGAATTTG pLKO_005 1214 3UTR 100% 13.200 18.480 N KCNB2 n/a
2 TRCN0000045002 CGACTATAATCTGAACGAGAA pLKO.1 795 3UTR 100% 4.050 5.670 N KCNB2 n/a
3 TRCN0000044998 GCGATTCTTATCCTCACCAAA pLKO.1 1311 3UTR 100% 4.950 3.960 N KCNB2 n/a
4 TRCN0000435909 CATCGTTTCTATGAACTTAAA pLKO_005 1905 3UTR 100% 13.200 9.240 N KCNB2 n/a
5 TRCN0000044999 GCTCGAAGTATGGAACTGATA pLKO.1 1936 3UTR 100% 4.950 3.465 N KCNB2 n/a
6 TRCN0000045000 GCTGTGTGTATTGCATGGTTT pLKO.1 1273 3UTR 100% 4.950 3.465 N KCNB2 n/a
7 TRCN0000045001 CCAAGCAGAAACTGTTCCCTT pLKO.1 2927 3UTR 100% 2.640 1.848 N KCNB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001745621.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.