Transcript: Human XR_001746200.2

PREDICTED: Homo sapiens KIAA2026 (KIAA2026), transcript variant X10, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIAA2026 (158358)
Length:
6849
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001746200.2
NBCI Gene record:
KIAA2026 (158358)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001746200.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365630 GATTGAACCCAGTCCATTAAA pLKO_005 2579 3UTR 100% 15.000 21.000 N KIAA2026 n/a
2 TRCN0000370722 GGCAATGGAACTGCAATTAAT pLKO_005 5154 3UTR 100% 15.000 21.000 N KIAA2026 n/a
3 TRCN0000365558 GTTACATCTAGAGGCTATTAT pLKO_005 1323 3UTR 100% 15.000 21.000 N KIAA2026 n/a
4 TRCN0000370707 GACTATGTTAGTACAAGTAAT pLKO_005 2244 3UTR 100% 13.200 18.480 N KIAA2026 n/a
5 TRCN0000365557 TCCGGAAGCAAGCCCGATAAA pLKO_005 3827 3UTR 100% 13.200 18.480 N KIAA2026 n/a
6 TRCN0000017447 GCTTTCAGTTACCGGAGCAAA pLKO.1 5657 3UTR 100% 4.950 3.960 N KIAA2026 n/a
7 TRCN0000017444 CCCACAGACAACAAATATAAA pLKO.1 4118 3UTR 100% 15.000 10.500 N KIAA2026 n/a
8 TRCN0000370767 CAACCTGATCATGATACATTT pLKO_005 3237 3UTR 100% 13.200 9.240 N KIAA2026 n/a
9 TRCN0000017445 GCCATTGTCAACAAGTGGTAA pLKO.1 5549 3UTR 100% 4.950 3.465 N KIAA2026 n/a
10 TRCN0000017446 GCAGGGAAGTTATTCTTGGTT pLKO.1 2068 3UTR 100% 3.000 2.100 N KIAA2026 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001746200.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.