Transcript: Human XR_001746405.1

PREDICTED: Homo sapiens collagen type XXVII alpha 1 chain (COL27A1), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
COL27A1 (85301)
Length:
5908
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001746405.1
NBCI Gene record:
COL27A1 (85301)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001746405.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430252 ATAACCAGCCATGCCAGTAAG pLKO_005 1868 3UTR 100% 10.800 15.120 N COL27A1 n/a
2 TRCN0000443451 TAGGAGTGTTGGGTCCGATTG pLKO_005 2952 3UTR 100% 6.000 8.400 N COL27A1 n/a
3 TRCN0000437530 CCGCATGCAGTCCAGTTTGAA pLKO_005 1088 3UTR 100% 5.625 7.875 N COL27A1 n/a
4 TRCN0000116604 CCTATCCAATTGCAACAAGAT pLKO.1 5409 3UTR 100% 4.950 6.930 N COL27A1 n/a
5 TRCN0000438144 ATCAGCCGGGTCCAGATGAAT pLKO_005 5778 3UTR 100% 5.625 3.938 N COL27A1 n/a
6 TRCN0000116603 CAGGGATTTATGGGATTCATT pLKO.1 3455 3UTR 100% 5.625 3.938 N COL27A1 n/a
7 TRCN0000116605 CGCTCAACCATCACAGAAGAT pLKO.1 1534 3UTR 100% 4.950 3.465 N COL27A1 n/a
8 TRCN0000116606 CCAGTTCAGTATCTACCCTGT pLKO.1 1120 3UTR 100% 2.160 1.080 Y COL27A1 n/a
9 TRCN0000425740 CTTGACCACTGCCACACCAAT pLKO_005 1291 3UTR 100% 4.950 3.465 N Defb2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001746405.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.