Transcript: Human XR_001747078.2

PREDICTED: Homo sapiens sphingomyelin synthase 1 (SGMS1), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SGMS1 (259230)
Length:
3146
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001747078.2
NBCI Gene record:
SGMS1 (259230)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001747078.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134296 GCGAAGAATAATGAAGCTCAT pLKO.1 1130 3UTR 100% 4.050 5.670 N SGMS1 n/a
2 TRCN0000136143 GATGCCAAATGGGTATAGGAA pLKO.1 798 3UTR 100% 3.000 4.200 N SGMS1 n/a
3 TRCN0000426072 GACGTGGTGGTGGCATATTAC pLKO_005 1356 3UTR 100% 13.200 10.560 N SGMS1 n/a
4 TRCN0000417723 ATATGATGCAGCAGCATAAAT pLKO_005 1882 3UTR 100% 15.000 10.500 N SGMS1 n/a
5 TRCN0000133932 CCTCAGTAGGCAAGTTAAATA pLKO.1 1559 3UTR 100% 15.000 10.500 N SGMS1 n/a
6 TRCN0000351060 TTACCTTGACTTAACCTATTG pLKO_005 1711 3UTR 100% 10.800 7.560 N Sgms1 n/a
7 TRCN0000133921 CCAACTGCGAAGAATAATGAA pLKO.1 1124 3UTR 100% 5.625 3.938 N SGMS1 n/a
8 TRCN0000134521 GCGTTGGACAACAATAAAGAA pLKO.1 1778 3UTR 100% 5.625 3.938 N SGMS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001747078.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.