Transcript: Human XR_001747926.1

PREDICTED: Homo sapiens tetratricopeptide repeat domain 17 (TTC17), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TTC17 (55761)
Length:
6594
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001747926.1
NBCI Gene record:
TTC17 (55761)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001747926.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154408 GCTACCTAAAGAAGACCCAAT pLKO.1 637 3UTR 100% 4.050 5.670 N TTC17 n/a
2 TRCN0000157031 GCCACTAAGCTGCTACTTCAA pLKO.1 2090 3UTR 100% 4.950 3.960 N TTC17 n/a
3 TRCN0000323394 GCCACTAAGCTGCTACTTCAA pLKO_005 2090 3UTR 100% 4.950 3.960 N TTC17 n/a
4 TRCN0000265303 TGGGTTTGAGCAAGCTATAAA pLKO_005 1048 3UTR 100% 15.000 10.500 N Ttc17 n/a
5 TRCN0000323402 TGGGTTTGAGCAAGCTATAAA pLKO_005 1048 3UTR 100% 15.000 10.500 N TTC17 n/a
6 TRCN0000323317 ATAGGGACAAACAGCATATTC pLKO_005 1545 3UTR 100% 13.200 9.240 N TTC17 n/a
7 TRCN0000323333 CTAGAACTTCCATATAGTATA pLKO_005 560 3UTR 100% 13.200 9.240 N TTC17 n/a
8 TRCN0000155667 CCAGGTCAAACGTGTAAAGAA pLKO.1 2590 3UTR 100% 5.625 3.938 N TTC17 n/a
9 TRCN0000157257 GCACCCGAATTGCCAAAGTTT pLKO.1 5143 3UTR 100% 5.625 3.938 N TTC17 n/a
10 TRCN0000156933 GCAGGTGGATTCACCAATGAA pLKO.1 226 3UTR 100% 5.625 3.938 N TTC17 n/a
11 TRCN0000158059 CCAGCGAACACTGAATGAGTT pLKO.1 1135 3UTR 100% 4.950 3.465 N TTC17 n/a
12 TRCN0000157554 GCATCCTCATGACCTAGTCAT pLKO.1 253 3UTR 100% 4.950 3.465 N TTC17 n/a
13 TRCN0000323393 CCTCATGACCTAGTCATATTA pLKO_005 257 3UTR 100% 15.000 9.000 N TTC17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001747926.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.