Transcript: Human XR_001748052.1

PREDICTED: Homo sapiens Rho guanine nucleotide exchange factor 17 (ARHGEF17), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARHGEF17 (9828)
Length:
8256
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001748052.1
NBCI Gene record:
ARHGEF17 (9828)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001748052.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047518 CCCGCCACATTTATGCCTATT pLKO.1 3229 3UTR 100% 10.800 15.120 N ARHGEF17 n/a
2 TRCN0000434994 CTATTCTGCCTATATCGATAA pLKO_005 3822 3UTR 100% 10.800 15.120 N ARHGEF17 n/a
3 TRCN0000047521 GTATCTGAATAACCAGGTGTT pLKO.1 5676 3UTR 100% 4.050 5.670 N ARHGEF17 n/a
4 TRCN0000437090 AGCGGAAGTCCCTGTCAAATC pLKO_005 1715 3UTR 100% 10.800 7.560 N ARHGEF17 n/a
5 TRCN0000047522 GAGGTTATTCAGAGCATAGTT pLKO.1 2734 3UTR 100% 5.625 3.938 N ARHGEF17 n/a
6 TRCN0000047519 GTTAAATCTAAGCAGCATGAA pLKO.1 1278 3UTR 100% 4.950 3.465 N ARHGEF17 n/a
7 TRCN0000047520 CCTGCCTTTCTCAAGTTCCTA pLKO.1 3889 3UTR 100% 3.000 2.100 N ARHGEF17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001748052.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.