Transcript: Human XR_001748622.2

PREDICTED: Homo sapiens ATP binding cassette subfamily D member 2 (ABCD2), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ABCD2 (225)
Length:
10068
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001748622.2
NBCI Gene record:
ABCD2 (225)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001748622.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423349 CTTTACCACTGCTCGAAATTT pLKO_005 2055 3UTR 100% 15.000 21.000 N ABCD2 n/a
2 TRCN0000105346 CCTCGGACTTTCATCATCAAA pLKO.1 1309 3UTR 100% 5.625 7.875 N Abcd2 n/a
3 TRCN0000059449 CGTTTGACATTGAGTGAAGAA pLKO.1 2995 3UTR 100% 4.950 6.930 N ABCD2 n/a
4 TRCN0000421825 AGTGACACATTGGCAATTAAA pLKO_005 2275 3UTR 100% 15.000 12.000 N ABCD2 n/a
5 TRCN0000281572 CATCATTGGCAAGCGTTTAAA pLKO_005 1005 3UTR 100% 15.000 12.000 N Abcd2 n/a
6 TRCN0000413626 CATCATTGGCAAGCGTTTAAA pLKO_005 1005 3UTR 100% 15.000 12.000 N ABCD2 n/a
7 TRCN0000059451 CGGACTTTCATCATCAAATTA pLKO.1 1312 3UTR 100% 15.000 12.000 N ABCD2 n/a
8 TRCN0000430233 GGAGCAGCAGTGGACTAATTA pLKO_005 1946 3UTR 100% 15.000 10.500 N ABCD2 n/a
9 TRCN0000059452 CCCTGATTCAGTGGATGATAT pLKO.1 2607 3UTR 100% 13.200 9.240 N ABCD2 n/a
10 TRCN0000105349 TCGGACTTTCATCATCAAATT pLKO.1 1311 3UTR 100% 13.200 9.240 N Abcd2 n/a
11 TRCN0000059448 CCAATCTCTTACGGAGGATAT pLKO.1 1512 3UTR 100% 10.800 7.560 N ABCD2 n/a
12 TRCN0000059450 GCAGATCAGATGAACCTCATT pLKO.1 1870 3UTR 100% 4.950 3.465 N ABCD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001748622.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.