Transcript: Human XR_001748641.2

PREDICTED: Homo sapiens WASH complex subunit 4 (WASHC4), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WASHC4 (23325)
Length:
5733
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001748641.2
NBCI Gene record:
WASHC4 (23325)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001748641.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267751 GAATATACATCTCCGAAATTT pLKO_005 3026 3UTR 100% 15.000 21.000 N Washc4 n/a
2 TRCN0000144476 CGAAGGCCAAAGAATATACAT pLKO.1 3015 3UTR 100% 5.625 4.500 N WASHC4 n/a
3 TRCN0000319285 CGAAGGCCAAAGAATATACAT pLKO_005 3015 3UTR 100% 5.625 4.500 N WASHC4 n/a
4 TRCN0000144707 GCACGGGAATTATGAATACAA pLKO.1 2567 3UTR 100% 5.625 4.500 N WASHC4 n/a
5 TRCN0000145538 CGTCATTTCATAGCAACAGTA pLKO.1 5081 3UTR 100% 4.950 3.960 N WASHC4 n/a
6 TRCN0000121551 CCCTGGATGAAATTATTGATA pLKO.1 680 3UTR 100% 5.625 3.938 N WASHC4 n/a
7 TRCN0000319355 CCCTGGATGAAATTATTGATA pLKO_005 680 3UTR 100% 5.625 3.938 N WASHC4 n/a
8 TRCN0000145155 GAAGGTGATTGCCAAATTCAA pLKO.1 463 3UTR 100% 5.625 3.938 N WASHC4 n/a
9 TRCN0000143408 CCTTATGAACAGTCCTCTCTT pLKO.1 283 3UTR 100% 4.950 3.465 N WASHC4 n/a
10 TRCN0000319354 CCTTATGAACAGTCCTCTCTT pLKO_005 283 3UTR 100% 4.950 3.465 N WASHC4 n/a
11 TRCN0000144607 GAGATACTTCTGGATTGCTAT pLKO.1 2035 3UTR 100% 4.950 3.465 N WASHC4 n/a
12 TRCN0000319284 GAGATACTTCTGGATTGCTAT pLKO_005 2035 3UTR 100% 4.950 3.465 N WASHC4 n/a
13 TRCN0000141250 CGGATGGTATTCACTGCACAT pLKO.1 3533 3UTR 100% 4.050 2.835 N WASHC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001748641.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.