Transcript: Human XR_001748686.2

PREDICTED: Homo sapiens inositol 1,4,5-trisphosphate receptor type 2 (ITPR2), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ITPR2 (3709)
Length:
8127
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001748686.2
NBCI Gene record:
ITPR2 (3709)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001748686.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421936 ACGAAATGGCCGCTCTATTAT pLKO_005 7643 3UTR 100% 15.000 21.000 N ITPR2 n/a
2 TRCN0000431806 GGTGAAGACGTGCTGATATTT pLKO_005 4491 3UTR 100% 15.000 21.000 N ITPR2 n/a
3 TRCN0000421588 GATTTGGACAGCCAAGTTAAT pLKO_005 5136 3UTR 100% 13.200 18.480 N ITPR2 n/a
4 TRCN0000423300 GTCTAATCAAGACGTAGATAA pLKO_005 3779 3UTR 100% 13.200 18.480 N ITPR2 n/a
5 TRCN0000414372 AGGGAATGAAAGGGCAATTAA pLKO_005 6058 3UTR 100% 15.000 10.500 N ITPR2 n/a
6 TRCN0000061287 CCTGGCTGTGTTCATCAATTT pLKO.1 7181 3UTR 100% 13.200 9.240 N ITPR2 n/a
7 TRCN0000430331 TGGATCCAGAAATAGACATTA pLKO_005 6130 3UTR 100% 13.200 9.240 N ITPR2 n/a
8 TRCN0000061283 GCACAATAACTCAGAATGAAA pLKO.1 1861 3UTR 100% 5.625 2.813 Y ITPR2 n/a
9 TRCN0000012445 CCTGGCTGTGTTCATCAATAT pLKO.1 7181 3UTR 100% 13.200 9.240 N Itpr3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001748686.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.