Transcript: Human XR_001750175.2

PREDICTED: Homo sapiens MAM domain containing glycosylphosphatidylinositol anchor 2 (MDGA2), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MDGA2 (161357)
Length:
3246
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001750175.2
NBCI Gene record:
MDGA2 (161357)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001750175.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356225 TGATATCAGTATCGATGTTAA pLKO_005 2008 3UTR 100% 13.200 10.560 N MDGA2 n/a
2 TRCN0000356168 TAACTTGACAGAGCTAATTAA pLKO_005 2807 3UTR 100% 15.000 10.500 N MDGA2 n/a
3 TRCN0000006966 GCCTGATGGATCAATGCAAAT pLKO.1 2159 3UTR 100% 10.800 7.560 N MDGA2 n/a
4 TRCN0000006964 GCCATAACATTAGTATGTGTT pLKO.1 1502 3UTR 100% 4.950 3.465 N MDGA2 n/a
5 TRCN0000006965 GCAGCTTTCTTGTTACAGGAA pLKO.1 2566 3UTR 100% 2.640 1.848 N MDGA2 n/a
6 TRCN0000006967 CCACAAACACTGCATATTGTT pLKO.1 3190 3UTR 100% 5.625 3.375 N MDGA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001750175.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.