Transcript: Human XR_001750438.2

PREDICTED: Homo sapiens methyltransferase like 3 (METTL3), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
METTL3 (56339)
Length:
2261
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001750438.2
NBCI Gene record:
METTL3 (56339)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001750438.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034717 GCCAAGGAACAATCCATTGTT pLKO.1 853 3UTR 100% 0.563 0.788 N METTL3 n/a
2 TRCN0000289742 GCCAAGGAACAATCCATTGTT pLKO_005 853 3UTR 100% 0.563 0.788 N METTL3 n/a
3 TRCN0000034716 CGTCAGTATCTTGGGCAAGTT pLKO.1 1256 3UTR 100% 4.950 3.960 N METTL3 n/a
4 TRCN0000289812 CGTCAGTATCTTGGGCAAGTT pLKO_005 1256 3UTR 100% 4.950 3.960 N METTL3 n/a
5 TRCN0000034715 GCAAGTATGTTCACTATGAAA pLKO.1 1087 3UTR 100% 5.625 3.938 N METTL3 n/a
6 TRCN0000289743 GCAAGTATGTTCACTATGAAA pLKO_005 1087 3UTR 100% 5.625 3.938 N METTL3 n/a
7 TRCN0000039111 CCTCAGTGGATCTGTTGTGAT pLKO.1 1221 3UTR 100% 4.950 3.465 N Mettl3 n/a
8 TRCN0000034714 GCCTTAACATTGCCCACTGAT pLKO.1 358 3UTR 100% 4.950 3.465 N METTL3 n/a
9 TRCN0000289813 GCCTTAACATTGCCCACTGAT pLKO_005 358 3UTR 100% 4.950 3.465 N METTL3 n/a
10 TRCN0000039109 CCAGTCATAAACCAGATGAAA pLKO.1 1927 3UTR 100% 5.625 3.375 N Mettl3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001750438.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.