Transcript: Human XR_001751393.1

PREDICTED: Homo sapiens SAFB like transcription modulator (SLTM), transcript variant X16, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLTM (79811)
Length:
4375
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001751393.1
NBCI Gene record:
SLTM (79811)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001751393.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134872 CTAGATACAGATGCACGATTT pLKO.1 2566 3UTR 100% 10.800 15.120 N SLTM n/a
2 TRCN0000343064 CTAGATACAGATGCACGATTT pLKO_005 2566 3UTR 100% 10.800 15.120 N SLTM n/a
3 TRCN0000136959 CCACTGACAAACGGGAAACAA pLKO.1 2990 3UTR 100% 5.625 7.875 N SLTM n/a
4 TRCN0000137418 GCAGGCATGATAACCCAACAT pLKO.1 3292 3UTR 100% 4.950 6.930 N SLTM n/a
5 TRCN0000343135 GCAGGCATGATAACCCAACAT pLKO_005 3292 3UTR 100% 4.950 6.930 N SLTM n/a
6 TRCN0000136741 GAGTTGAAAGGCCAGAACGAT pLKO.1 3011 3UTR 100% 3.000 4.200 N SLTM n/a
7 TRCN0000135106 CCCAACATTCAAGTAACGCAT pLKO.1 3305 3UTR 100% 2.640 3.696 N SLTM n/a
8 TRCN0000352742 CCCAACATTCAAGTAACGCAT pLKO_005 3305 3UTR 100% 2.640 3.696 N SLTM n/a
9 TRCN0000133827 CTCCGGATTTAAGCCATTTAA pLKO.1 3381 3UTR 100% 15.000 12.000 N SLTM n/a
10 TRCN0000136117 GCTCCGGATTTAAGCCATTTA pLKO.1 3380 3UTR 100% 13.200 10.560 N SLTM n/a
11 TRCN0000190432 CCACCACCAAGAAATGAACTT pLKO.1 2815 3UTR 100% 4.950 3.465 N Sltm n/a
12 TRCN0000191656 GAGAGAACATTTAGTTCGTTT pLKO.1 2347 3UTR 100% 4.950 3.465 N Sltm n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001751393.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.