Transcript: Human XR_001751409.2

PREDICTED: Homo sapiens IQ motif containing GTPase activating protein 1 (IQGAP1), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IQGAP1 (8826)
Length:
6550
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001751409.2
NBCI Gene record:
IQGAP1 (8826)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001751409.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047483 GCCCACATTGTGCCTTTATTT pLKO.1 6266 3UTR 100% 15.000 10.500 N IQGAP1 n/a
2 TRCN0000298930 GCCCACATTGTGCCTTTATTT pLKO_005 6266 3UTR 100% 15.000 10.500 N IQGAP1 n/a
3 TRCN0000047486 CCTCAGATTCAAGACCTATAT pLKO.1 577 3UTR 100% 13.200 9.240 N IQGAP1 n/a
4 TRCN0000298856 CCTCAGATTCAAGACCTATAT pLKO_005 577 3UTR 100% 13.200 9.240 N IQGAP1 n/a
5 TRCN0000047487 GCATCCACTTACCAGGATATA pLKO.1 844 3UTR 100% 13.200 9.240 N IQGAP1 n/a
6 TRCN0000298931 GCATCCACTTACCAGGATATA pLKO_005 844 3UTR 100% 13.200 9.240 N IQGAP1 n/a
7 TRCN0000047484 CCCACAAAGATGAAGTTGTAA pLKO.1 2492 3UTR 100% 5.625 3.938 N IQGAP1 n/a
8 TRCN0000298929 CCCACAAAGATGAAGTTGTAA pLKO_005 2492 3UTR 100% 5.625 3.938 N IQGAP1 n/a
9 TRCN0000047485 CCAGTAATCTACATTTCCATT pLKO.1 4006 3UTR 100% 4.950 3.465 N IQGAP1 n/a
10 TRCN0000298928 CCAGTAATCTACATTTCCATT pLKO_005 4006 3UTR 100% 4.950 3.465 N IQGAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001751409.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.