Transcript: Human XR_001751917.2

PREDICTED: Homo sapiens protein arginine methyltransferase 7 (PRMT7), transcript variant X22, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRMT7 (54496)
Length:
2495
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001751917.2
NBCI Gene record:
PRMT7 (54496)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001751917.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035150 GCTAACCACTTGGAAGATAAA pLKO.1 1632 3UTR 100% 13.200 18.480 N PRMT7 n/a
2 TRCN0000359087 GGTCGTGGAACAAGCTATTTC pLKO_005 871 3UTR 100% 13.200 18.480 N PRMT7 n/a
3 TRCN0000035152 CGATGACTACTGCGTATGGTA pLKO.1 1316 3UTR 100% 3.000 4.200 N PRMT7 n/a
4 TRCN0000359084 AGGTGTCACCAGCCGACTTTA pLKO_005 994 3UTR 100% 13.200 9.240 N PRMT7 n/a
5 TRCN0000359004 ATGGCTTTAGTGATAAGATTA pLKO_005 628 3UTR 100% 13.200 9.240 N PRMT7 n/a
6 TRCN0000359002 CTCGTGGTGGGACATTGAAAT pLKO_005 1136 3UTR 100% 13.200 9.240 N PRMT7 n/a
7 TRCN0000035151 CATGACAAAGACAGAAATGTA pLKO.1 417 3UTR 100% 5.625 3.938 N PRMT7 n/a
8 TRCN0000035149 GCCCATGTTCAGCATAGACTT pLKO.1 1034 3UTR 100% 4.950 3.465 N PRMT7 n/a
9 TRCN0000035153 CACATCATGGACGACATGATT pLKO.1 1926 3UTR 100% 0.563 0.394 N PRMT7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001751917.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.