Transcript: Human XR_001751997.1

PREDICTED: Homo sapiens NLR family CARD domain containing 5 (NLRC5), transcript variant X9, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NLRC5 (84166)
Length:
6897
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001751997.1
NBCI Gene record:
NLRC5 (84166)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001751997.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127850 GCAGATAGAGAATCTCAGCTT pLKO.1 2246 3UTR 100% 2.640 3.696 N NLRC5 n/a
2 TRCN0000426486 TTTCGCCCACTGGGATAATTG pLKO_005 5961 3UTR 100% 13.200 10.560 N NLRC5 n/a
3 TRCN0000128097 CCTTGCTTACTCACAGACTAA pLKO.1 4891 3UTR 100% 4.950 3.960 N NLRC5 n/a
4 TRCN0000419168 ACATGATTGTTGGTCTATATA pLKO_005 6292 3UTR 100% 15.000 10.500 N NLRC5 n/a
5 TRCN0000422323 AGCTGGACTTGTCTAACAATC pLKO_005 4765 3UTR 100% 10.800 7.560 N NLRC5 n/a
6 TRCN0000130765 GTAATCTTGCTGTCCTGGAAT pLKO.1 5618 3UTR 100% 4.950 3.465 N NLRC5 n/a
7 TRCN0000131176 GCAACTCAACAAGCTGCATGT pLKO.1 356 3UTR 100% 4.050 2.835 N NLRC5 n/a
8 TRCN0000131102 GCACCATGCAACTTTGCACTT pLKO.1 3791 3UTR 100% 4.050 2.835 N NLRC5 n/a
9 TRCN0000128098 CCTGTAAGATTGACAACCAGA pLKO.1 5550 3UTR 100% 2.640 1.848 N NLRC5 n/a
10 TRCN0000130153 CAGATAGAGAATCTCAGCTTT pLKO.1 2247 3UTR 100% 4.950 2.970 N NLRC5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001751997.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.