Transcript: Human XR_001752001.2

PREDICTED: Homo sapiens TNF receptor associated factor 7 (TRAF7), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRAF7 (84231)
Length:
2413
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001752001.2
NBCI Gene record:
TRAF7 (84231)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001752001.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056948 CGGGACGCATCCATGTTAAAT pLKO.1 1185 3UTR 100% 15.000 21.000 N TRAF7 n/a
2 TRCN0000056949 CTACTCCATTGCTGTGACAAA pLKO.1 1722 3UTR 100% 4.950 3.465 N TRAF7 n/a
3 TRCN0000056950 GCACTGTGAAGGTTTGGACTT pLKO.1 2024 3UTR 100% 4.050 2.835 N TRAF7 n/a
4 TRCN0000056951 GACCAGAATGGAAACGACCTT pLKO.1 200 3UTR 100% 2.640 1.848 N TRAF7 n/a
5 TRCN0000056952 GCTGGGAAAGCTCTCGGAGAA pLKO.1 1073 3UTR 100% 1.350 0.945 N TRAF7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001752001.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.