Transcript: Human XR_001752706.1

PREDICTED: Homo sapiens transmembrane protein 94 (TMEM94), transcript variant X25, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM94 (9772)
Length:
3264
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001752706.1
NBCI Gene record:
TMEM94 (9772)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001752706.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420767 AGTCGGTGATGCTACACTATG pLKO_005 1047 3UTR 100% 10.800 15.120 N TMEM94 n/a
2 TRCN0000412471 ACCATGTGTGAGATGATAAAG pLKO_005 3120 3UTR 100% 13.200 10.560 N TMEM94 n/a
3 TRCN0000420536 CCTACGAAGCAGAGGACTTTG pLKO_005 1851 3UTR 100% 10.800 7.560 N TMEM94 n/a
4 TRCN0000061863 GCGAGGGATCATTGACCAAAT pLKO.1 601 3UTR 100% 10.800 7.560 N TMEM94 n/a
5 TRCN0000425045 GGATACTCTCAGCAGCTATAC pLKO_005 1306 3UTR 100% 10.800 7.560 N TMEM94 n/a
6 TRCN0000061864 CCGCTTTGTCTACTTCTCTTT pLKO.1 2723 3UTR 100% 4.950 3.465 N TMEM94 n/a
7 TRCN0000061866 GAGCCCTATTCACACCACAAA pLKO.1 1721 3UTR 100% 4.950 3.465 N TMEM94 n/a
8 TRCN0000061865 GCTGGTTGAAGGAGACATCAT pLKO.1 760 3UTR 100% 4.950 3.465 N TMEM94 n/a
9 TRCN0000189444 CCATGTATCCAGACCTCCATA pLKO.1 666 3UTR 100% 4.950 2.970 N Tmem94 n/a
10 TRCN0000328561 CCATGTATCCAGACCTCCATA pLKO_005 666 3UTR 100% 4.950 2.970 N Tmem94 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001752706.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.