Transcript: Human XR_001753186.1

PREDICTED: Homo sapiens cadherin 20 (CDH20), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDH20 (28316)
Length:
2072
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001753186.1
NBCI Gene record:
CDH20 (28316)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001753186.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431186 ATCAATGCAGAGATGAAATAT pLKO_005 1311 3UTR 100% 15.000 10.500 N CDH20 n/a
2 TRCN0000416072 GAACAACCATACAGATCATTT pLKO_005 1612 3UTR 100% 13.200 9.240 N CDH20 n/a
3 TRCN0000418027 GAACAACCATACAGATCATTT pLKO_005 1612 3UTR 100% 13.200 9.240 N Cdh20 n/a
4 TRCN0000056512 GAGAGGAAAGAGCCCAGTATA pLKO.1 769 3UTR 100% 13.200 9.240 N CDH20 n/a
5 TRCN0000426088 AGTTCCTGGACGGACCTTATG pLKO_005 889 3UTR 100% 10.800 7.560 N CDH20 n/a
6 TRCN0000056509 CCCTCTCAGATGTCAATGATA pLKO.1 1186 3UTR 100% 5.625 3.938 N CDH20 n/a
7 TRCN0000056508 CCTGTCACAATCAAAGTCTTA pLKO.1 1833 3UTR 100% 4.950 3.465 N CDH20 n/a
8 TRCN0000056510 GCCTTTGACATTAGCACAGAT pLKO.1 1359 3UTR 100% 4.950 3.465 N CDH20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001753186.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.