Transcript: Human XR_001753256.1

PREDICTED: Homo sapiens ectopic P-granules autophagy protein 5 homolog (EPG5), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EPG5 (57724)
Length:
12573
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001753256.1
NBCI Gene record:
EPG5 (57724)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001753256.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432059 ATTGCAAGCCACCCAATTTAT pLKO_005 7595 3UTR 100% 15.000 21.000 N EPG5 n/a
2 TRCN0000431105 GCTAACCAAGTTCGATCTTAA pLKO_005 5377 3UTR 100% 13.200 18.480 N EPG5 n/a
3 TRCN0000429673 TGGACCACATACGATAGTTAA pLKO_005 7699 3UTR 100% 13.200 18.480 N EPG5 n/a
4 TRCN0000434550 CACAAGTAACTTTGCTCAATT pLKO_005 7777 3UTR 100% 13.200 10.560 N EPG5 n/a
5 TRCN0000134858 CCTTTAATAGAGCACGCTATA pLKO.1 1971 3UTR 100% 10.800 8.640 N EPG5 n/a
6 TRCN0000137044 CGTACCAGAGTGTGCTAAGTT pLKO.1 6454 3UTR 100% 5.625 3.938 N EPG5 n/a
7 TRCN0000134096 CTTGACTCTTTACGTCTACTT pLKO.1 7091 3UTR 100% 4.950 3.465 N EPG5 n/a
8 TRCN0000135983 GCTGTTAGACACAATGCCAAA pLKO.1 4774 3UTR 100% 4.050 2.835 N EPG5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001753256.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.