Transcript: Human XR_001753627.2

PREDICTED: Homo sapiens ELAV like RNA binding protein 1 (ELAVL1), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ELAVL1 (1994)
Length:
5250
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001753627.2
NBCI Gene record:
ELAVL1 (1994)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001753627.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221647 GAGAACGAATTTGATCGTCAA pLKO.1 69 3UTR 100% 4.050 5.670 N ELAVL1 n/a
2 TRCN0000276129 CGAGCTCAGAGGTGATCAAAG pLKO_005 308 3UTR 100% 10.800 8.640 N ELAVL1 n/a
3 TRCN0000276126 TACCAGTTTCAATGGTCATAA pLKO_005 507 3UTR 100% 0.000 0.000 N ELAVL1 n/a
4 TRCN0000276186 TTGTTAGTGTACAACTCATTT pLKO_005 1058 3UTR 100% 13.200 9.240 N ELAVL1 n/a
5 TRCN0000221645 GCAGCATTGGTGAAGTTGAAT pLKO.1 137 3UTR 100% 5.625 3.938 N ELAVL1 n/a
6 TRCN0000285493 GCAGCATTGGTGAAGTTGAAT pLKO_005 137 3UTR 100% 5.625 3.938 N ELAVL1 n/a
7 TRCN0000221646 ACCATGACAAACTATGAAGAA pLKO.1 886 3UTR 100% 4.950 3.465 N ELAVL1 n/a
8 TRCN0000221644 CGTGGATCAGACTACAGGTTT pLKO.1 429 3UTR 100% 4.950 3.465 N ELAVL1 n/a
9 TRCN0000221648 CCCATCACAGTGAAGTTTGCA pLKO.1 547 3UTR 100% 3.000 2.100 N ELAVL1 n/a
10 TRCN0000285492 CCCATCACAGTGAAGTTTGCA pLKO_005 547 3UTR 100% 3.000 2.100 N ELAVL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001753627.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.