Transcript: Human XR_001753712.1

PREDICTED: Homo sapiens Ras interacting protein 1 (RASIP1), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RASIP1 (54922)
Length:
3059
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001753712.1
NBCI Gene record:
RASIP1 (54922)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001753712.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437267 CCACTGAGTTCTTCCGGAAAC pLKO_005 2687 3UTR 100% 6.000 8.400 N RASIP1 n/a
2 TRCN0000437581 TCGCTGATGGAACGAGGTCAA pLKO_005 2569 3UTR 100% 4.050 5.670 N RASIP1 n/a
3 TRCN0000077906 CCCGAGCTGTTCAAATCCGAA pLKO.1 2612 3UTR 100% 2.640 1.848 N RASIP1 n/a
4 TRCN0000222740 GCGCAGCCTCTGTCAAGTCTT pLKO.1 439 3UTR 100% 1.650 1.155 N RASIP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001753712.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.