Transcript: Human XR_001754163.1

PREDICTED: Homo sapiens phosphatidylinositol glycan anchor biosynthesis class U (PIGU), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PIGU (128869)
Length:
1540
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001754163.1
NBCI Gene record:
PIGU (128869)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001754163.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428147 ACTATGCTGAATTGGTGTTTA pLKO_005 251 3UTR 100% 13.200 18.480 N PIGU n/a
2 TRCN0000413660 GAAGCCTAGTGGTAATCATTT pLKO_005 756 3UTR 100% 13.200 18.480 N PIGU n/a
3 TRCN0000416343 ACTGATGCACTCACTGCTATT pLKO_005 277 3UTR 100% 10.800 15.120 N PIGU n/a
4 TRCN0000128579 GCAATCCAGGACTTCAATAAA pLKO.1 310 3UTR 100% 15.000 10.500 N PIGU n/a
5 TRCN0000421459 CCGTATTCTGGAGCAGTATTT pLKO_005 187 3UTR 100% 13.200 9.240 N PIGU n/a
6 TRCN0000129318 CCTGCATCATCATCGTCTGTT pLKO.1 984 3UTR 100% 4.950 3.465 N PIGU n/a
7 TRCN0000129146 GTTTATCCAGATCGCTGTCAT pLKO.1 856 3UTR 100% 4.950 3.465 N PIGU n/a
8 TRCN0000129213 CCTGAGAAACATCTTTGTCCT pLKO.1 961 3UTR 100% 2.640 1.848 N PIGU n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001754163.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.