Transcript: Human XR_001754167.1

PREDICTED: Homo sapiens zinc finger and BTB domain containing 46 (ZBTB46), transcript variant X9, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZBTB46 (140685)
Length:
1549
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001754167.1
NBCI Gene record:
ZBTB46 (140685)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001754167.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156585 GCTACTTCAAGACGCTCTACT pLKO.1 257 3UTR 100% 4.950 6.930 N ZBTB46 n/a
2 TRCN0000158196 CAAGGCCATCATCGACTTCAT pLKO.1 345 3UTR 100% 4.950 3.465 N ZBTB46 n/a
3 TRCN0000157893 CGGTGCAGTACAGAACTCTTT pLKO.1 840 3UTR 100% 4.950 3.465 N ZBTB46 n/a
4 TRCN0000152836 GATGTTTCTTCACAGCCTCTA pLKO.1 724 3UTR 100% 4.050 2.835 N ZBTB46 n/a
5 TRCN0000152567 GAAGAAGTTCAAGTGTCCGTA pLKO.1 1521 3UTR 100% 2.640 1.848 N ZBTB46 n/a
6 TRCN0000156660 GCTCATGAGTAAGAACAGCCT pLKO.1 1215 3UTR 100% 0.660 0.462 N ZBTB46 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001754167.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.