Transcript: Human XR_001755655.1

PREDICTED: Homo sapiens GRB2 associated binding protein 3 (GAB3), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GAB3 (139716)
Length:
1602
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001755655.1
NBCI Gene record:
GAB3 (139716)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001755655.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180562 GACCCAAACACTAATGCCGTA pLKO.1 506 3UTR 100% 2.160 3.024 N GAB3 n/a
2 TRCN0000179872 CAAGACTACTTCCCGTACATT pLKO.1 289 3UTR 100% 5.625 4.500 N GAB3 n/a
3 TRCN0000146923 CAAGCGGCTTAGTTTGAATTT pLKO.1 1129 3UTR 100% 13.200 9.240 N GAB3 n/a
4 TRCN0000421776 GAATCTCCCTCTCTGGTTTAG pLKO_005 1053 3UTR 100% 10.800 7.560 N GAB3 n/a
5 TRCN0000100173 CAGATGTGATAGCTGGTCAAA pLKO.1 631 3UTR 100% 4.950 3.465 N Gab3 n/a
6 TRCN0000148678 CCACTTGTCTTCTTCACCATT pLKO.1 832 3UTR 100% 4.950 3.465 N GAB3 n/a
7 TRCN0000179952 CCCTGATGACTACATTCCAAT pLKO.1 1258 3UTR 100% 4.950 3.465 N GAB3 n/a
8 TRCN0000100174 CCAGATGTGATAGCTGGTCAA pLKO.1 630 3UTR 100% 4.050 2.835 N Gab3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001755655.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.