Transcript: Human XR_001755656.2

PREDICTED: Homo sapiens cleavage stimulation factor subunit 2 (CSTF2), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CSTF2 (1478)
Length:
5920
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001755656.2
NBCI Gene record:
CSTF2 (1478)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001755656.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000278955 GAATTGTGGATCCGGAAATTG pLKO_005 587 3UTR 100% 13.200 18.480 N CSTF2 n/a
2 TRCN0000278882 GCAGGGTCCCAGTCCAATTAA pLKO_005 2019 3UTR 100% 15.000 10.500 N CSTF2 n/a
3 TRCN0000157313 CAGAACCCTCAACTGGCTTAT pLKO.1 538 3UTR 100% 10.800 7.560 N CSTF2 n/a
4 TRCN0000153738 CCTGGCAAGAAATCTGGAAAT pLKO.1 3113 3UTR 100% 10.800 7.560 N CSTF2 n/a
5 TRCN0000278953 CCTGGCAAGAAATCTGGAAAT pLKO_005 3113 3UTR 100% 10.800 7.560 N CSTF2 n/a
6 TRCN0000153435 CCTGTCATTGAGTCACCTTAT pLKO.1 373 3UTR 100% 10.800 7.560 N CSTF2 n/a
7 TRCN0000278954 TGTTAGTTTCAGATTGGTATA pLKO_005 174 3UTR 100% 10.800 7.560 N CSTF2 n/a
8 TRCN0000153703 CTTTCTGTAACTGGAGAGGTA pLKO.1 1576 3UTR 100% 2.640 1.848 N CSTF2 n/a
9 TRCN0000157143 GAGCAAGTATACAGGGTGGAA pLKO.1 2105 3UTR 100% 2.640 1.848 N CSTF2 n/a
10 TRCN0000278880 GAGCAAGTATACAGGGTGGAA pLKO_005 2105 3UTR 100% 2.640 1.848 N CSTF2 n/a
11 TRCN0000158299 CCAGACAAATATCCCAACGCT pLKO.1 627 3UTR 100% 0.750 0.525 N CSTF2 n/a
12 TRCN0000150935 GCTTTGATTATGCAGGTTCTA pLKO.1 2977 3UTR 100% 4.950 2.970 N CSTF2 n/a
13 TRCN0000102282 GCACAGGTAGTGATGAGAATT pLKO.1 571 3UTR 100% 0.000 0.000 N Cstf2 n/a
14 TRCN0000326096 GCACAGGTAGTGATGAGAATT pLKO_005 571 3UTR 100% 0.000 0.000 N Cstf2 n/a
15 TRCN0000141117 CAAAGGCAGAGTATCCTGATT pLKO.1 3037 3UTR 100% 4.950 2.475 Y CSTF2T n/a
16 TRCN0000139957 GCAAAGGCAGAGTATCCTGAT pLKO.1 3036 3UTR 100% 4.050 2.025 Y CSTF2T n/a
17 TRCN0000157598 GCAAAGGCAGAGTATCCTGAT pLKO.1 3036 3UTR 100% 4.050 2.025 Y CSTF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001755656.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.