Transcript: Mouse XR_001778003.1

PREDICTED: Mus musculus syntrophin, gamma 1 (Sntg1), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sntg1 (71096)
Length:
4402
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001778003.1
NBCI Gene record:
Sntg1 (71096)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001778003.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112972 CCAAGCAATAGCATCTAACAT pLKO.1 3875 3UTR 100% 5.625 7.875 N Sntg1 n/a
2 TRCN0000112973 GCAGAACATAACATCCCGGTT pLKO.1 3333 3UTR 100% 2.160 3.024 N Sntg1 n/a
3 TRCN0000112971 GCGGAAACATTGCTTCACTAT pLKO.1 4177 3UTR 100% 4.950 3.465 N Sntg1 n/a
4 TRCN0000149807 GAGCCTTTCTATTCTGGTGAA pLKO.1 3252 3UTR 100% 4.050 2.835 N SNTG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001778003.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.