Transcript: Mouse XR_001778035.1

PREDICTED: Mus musculus predicted gene 7696 (Gm7696), misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm7696 (665577)
Length:
1294
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001778035.1
NBCI Gene record:
Gm7696 (665577)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001778035.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226345 ACAGAGCTCCTTAGGTCTTCT pLKO_005 521 3UTR 100% 4.950 3.465 N Gm7696 n/a
2 TRCN0000226346 ATGAAGTGACTTACACTATTG pLKO_005 547 3UTR 100% 10.800 6.480 N Gm7696 n/a
3 TRCN0000226348 CCATAGAAGTATACTATAGTA pLKO_005 953 3UTR 100% 5.625 2.813 Y Gm7696 n/a
4 TRCN0000226347 CAGAGTGAGAAGAACTGCATA pLKO_005 606 3UTR 100% 4.950 2.475 Y Gm7696 n/a
5 TRCN0000191401 CCCAATTAAATGTTGTCCTTT pLKO.1 1270 3UTR 100% 4.950 2.475 Y D130079A08Rik n/a
6 TRCN0000218071 GTTGTTGGATCAAAGTGCATA pLKO_005 379 3UTR 100% 4.950 2.475 Y Gm7696 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001778035.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.