Transcript: Mouse XR_001778040.1

PREDICTED: Mus musculus RIKEN cDNA 2010300C02 gene (2010300C02Rik), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
2010300C02Rik (72097)
Length:
5658
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001778040.1
NBCI Gene record:
2010300C02Rik (72097)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001778040.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000346556 TGTGAAACTTACGATTGATTT pLKO_005 5162 3UTR 100% 13.200 18.480 N 2010300C02Rik n/a
2 TRCN0000346559 ACCTGGGTCGAGGATCCTAAA pLKO_005 3731 3UTR 100% 10.800 15.120 N 2010300C02Rik n/a
3 TRCN0000346487 CGCAACCAGCGATCAAGTAAA pLKO_005 1260 3UTR 100% 13.200 10.560 N 2010300C02Rik n/a
4 TRCN0000346488 CCACCTCACTCTCACTTAAAT pLKO_005 3238 3UTR 100% 15.000 10.500 N 2010300C02Rik n/a
5 TRCN0000346557 GAATCATGGAGCCTCCTAATA pLKO_005 2482 3UTR 100% 13.200 9.240 N 2010300C02Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001778040.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.