Transcript: Mouse XR_001778453.1

PREDICTED: Mus musculus RNA binding motif protein 34 (Rbm34), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rbm34 (52202)
Length:
1720
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001778453.1
NBCI Gene record:
Rbm34 (52202)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001778453.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000174787 GAAGGATGTCATTAAACCTAA pLKO.1 1323 3UTR 100% 4.950 6.930 N Rbm34 n/a
2 TRCN0000173494 GACAAGTAGAATCCGTACGAT pLKO.1 728 3UTR 100% 3.000 4.200 N Rbm34 n/a
3 TRCN0000194216 GCATATGTAGTGTTCAAGGAT pLKO.1 925 3UTR 100% 0.000 0.000 N Rbm34 n/a
4 TRCN0000412959 GTCATGCGTTCTGTTAATAAA pLKO_005 1264 3UTR 100% 15.000 12.000 N Rbm34 n/a
5 TRCN0000175324 CAAGTAGAATCCGTACGATTT pLKO.1 730 3UTR 100% 10.800 8.640 N Rbm34 n/a
6 TRCN0000216172 CAAGAAGTTGGCTGCAATAAA pLKO.1 783 3UTR 100% 15.000 10.500 N Rbm34 n/a
7 TRCN0000428801 ATTGCAGAAGGATTTCGTATT pLKO_005 988 3UTR 100% 10.800 7.560 N Rbm34 n/a
8 TRCN0000173858 GCAAACAGGGAAAGTGCTCTA pLKO.1 451 3UTR 100% 4.050 2.835 N Rbm34 n/a
9 TRCN0000174497 CATCAATGCATATGTAGTGTT pLKO.1 918 3UTR 100% 0.000 0.000 N Rbm34 n/a
10 TRCN0000147509 GCTATGTGCTCTTTGAGAATA pLKO.1 1181 3UTR 100% 13.200 9.240 N RBM34 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001778453.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.